Высокоэффективная жидкостная хроматография в частично денатурирующих

Идентификация вариации числа копий CAPN10 у тайцев с диабетом 2 типа с помощью мультиплексной ПЦР и денатурирующей высокоэффективной жидкостной хроматографии ( DHPLC ).

 Было показано, что вариации числа копий (CNV) связаны с несколькими заболеваниями. Они могут вызывать отклонение генотипов от равновесия Харди-Вайнберга (HWE) . Исследования ассоциации генетический случай-контроль в Тайланде показали, что распределение генотипов CAPN10 Indel19 отклонялось от HWE после исправления ошибки генотипирования. Таким образом, мы стремимся идентифицировать CNV в области CAPN10 Indel19.

Метод полуколичественной денатурирующей высокоэффективной жидкостной хроматографии (DHPLC) был использован для обнаружения CNV в области маркера CAPN10 Indel19 в когорте 305 пациентов с диабетом 2 типа и 250 контрольных субъектов без диабета. CNVs в области CAPN10 Indel19 был успешно обнаружен с помощью DHPLC .

После корректировки определения генотипа на основе статуса идентифицированных CNV, генотипы CAPN10 Indel19 были хорошо приспособлены для HWE (p> 0,05) . Однако мы не обнаружили связи между генотипами CNV и риском диабета 2 типа в нашей популяции. CNV в CAPN10 были идентифицированы у тайцев. Эти CNVs приводят к отклонению от HWE генотипов CAPN10 Indel19 . После исключения идентифицированных CNV из анализа, CAPN10 Indel19 был связан с диабетом 2 типа. Информация, полученная в результате нашего исследования, может быть полезна для точности генотипирования SNP, находящихся в области CNV .

 

Нуклеаза DHPLC / SURVEYOR: чувствительный, быстрый и доступный метод анализа мутаций BRCA1 и BRCA2 в семьях рака груди.

 Наследственный рак молочной железы составляет около 10% всех случаев рака молочной железы, и гены BRCA1 и BRCA2 были идентифицированы как проверенные гены предрасположенности к этой патологии. Тестирование на мутации гена BRCA обычно основано на подходе предварительного скрининга, таком как метод частичной денатурации DHPLC и прямое капиллярное секвенирование.

Однако этот подход требует много времени из-за большого размера генов BRCA1 и BRCA2. Недавно был разработан новый недорогой и экономящий время протокол DHPLC для анализа генных мутаций с использованием расщепления нуклеазой SURVEYOR® и анализа DHPLC . Подгруппа из 90 пациентов, включенных в Программу генетического консультирования Национального онкологического центра Бари (Италия), была проведена для проверки этого подхода.

Предыдущий ретроспективный анализ показал, что 9/90 пациентов (10%) были мутированы в генах BRCA1 и BRCA2, и эти данные были подтверждены настоящим подходом. Образцы ДНК были подвергнуты Landing PCR и, впоследствии, расщеплению нуклеазой SURVEYOR (®). Ампликоны BRCA1 и BRCA2 были разделены на группы в зависимости от размера ампликона, чтобы обеспечить переваривание нескольких ампликонов.

Продукт этой реакции анализировали на системе анализа высокочувствительных фрагментов трансгеномной нуклеиновой кислоты WAVE . Оператор, выполнявший метод обследования DHPLC, в то время не знал результатов секвенирования. СЮРВЕЙЕРСКИЙ (®) нуклеаза DHPLC подход был способен обнаружить все изменения с чувствительностью 95%. Кроме того, чтобы сэкономить время и реагенты, был утвержден препарат для настройки мультиампликона.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
DLR-MYH1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RD-MYH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RD-MYH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RDR-MYH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RDR-MYH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
DLR-MYH1-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
DLR-MYH1-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RD-MYH1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RD-MYH1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RDR-MYH1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RDR-MYH1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Myosin 1(MYH1) ELISA kit
E01M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Myosin 1(MYH1) ELISA kit
E01M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Myosin 1(MYH1) ELISA kit
E01M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MYH1/ Myosin-1 ELISA Kit
E1687Hu	Sunlong	1 Kit	EUR 571

Human MYH1(Myosin-1) ELISA Kit
EH0735	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P12882 Alias: MYH1(Myosin Heavy Chain 1, Skeletal Muscle, Adult)/Myosin-1/Myosin heavy chain 1/Myosin heavy chain 2x(MyHC-2x)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Rat Myosin 1(MYH1) ELISA kit
E02M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Myosin 1(MYH1) ELISA kit
E02M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Myosin 1(MYH1) ELISA kit
E02M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myosin 1(MYH1) ELISA kit
E03M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myosin 1(MYH1) ELISA kit
E03M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myosin 1(MYH1) ELISA kit
E03M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit
E04M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit
E04M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit
E04M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myosin 1(MYH1) ELISA kit
E08M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myosin 1(MYH1) ELISA kit
E08M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myosin 1(MYH1) ELISA kit
E08M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Myosin 1(MYH1) ELISA kit
E07M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Myosin 1(MYH1) ELISA kit
E07M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Myosin 1(MYH1) ELISA kit
E07M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myosin 1(MYH1) ELISA kit
E06M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myosin 1(MYH1) ELISA kit
E06M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myosin 1(MYH1) ELISA kit
E06M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Myosin 1(MYH1) ELISA kit
E09M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Myosin 1(MYH1) ELISA kit
E09M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Myosin 1(MYH1) ELISA kit
E09M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig MYH1/ Myosin-1 ELISA Kit
E0133Pi	Sunlong	1 Kit	EUR 717

Bovine MYH1/ Myosin-1 ELISA Kit
E0186Bo	Sunlong	1 Kit	EUR 717

Recombinant Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)
4-RPA754Hu01	Cloud-Clone	EUR 481.70 EUR 232.00 EUR 1531.36 EUR 577.12 EUR 1054.24 EUR 385.00 EUR 3678.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12882 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.0kDa Isoelectric Point: 9.6
Description: Recombinant Human Myosin Heavy Chain 1, Skeletal Muscle, Adult expressed in: E.coli

Recombinant Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)
4-RPA754Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5SX40 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 37.5kDa Isoelectric Point: 5.6
Description: Recombinant Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult expressed in: E.coli

Guinea pig Myosin 1(MYH1) ELISA kit
E05M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Myosin 1(MYH1) ELISA kit
E05M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Myosin 1(MYH1) ELISA kit
E05M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Myosin heavy polypeptide 1 (MYH1) polyclonal antibody
ABP-PAB-01616	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

ELISA kit for Bovine Myosin-1 (MYH1)
KTE10236-48T	Abbkine	48T	EUR 354
Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myosin-1 (MYH1)
KTE10236-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Myosin-1 (MYH1)
KTE10236-96T	Abbkine	96T	EUR 572
Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi Show more
Description: Quantitative sandwich ELISA for measuring Bovine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myosin-1 (MYH1)
KTE20052-48T	Abbkine	48T	EUR 354
Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi Show more
Description: Quantitative sandwich ELISA for measuring Canine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myosin-1 (MYH1)
KTE20052-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi Show more
Description: Quantitative sandwich ELISA for measuring Canine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Myosin-1 (MYH1)
KTE20052-96T	Abbkine	96T	EUR 572
Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosi Show more
Description: Quantitative sandwich ELISA for measuring Canine Myosin-1 (MYH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Protein
20-abx168162	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
20-abx128730	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
20-abx104339	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
20-abx005265	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
20-abx173673	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
20-abx177671	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
20-abx320249	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
abx235469-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
abx235470-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
20-abx212233	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody
20-abx212641	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx570236-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
20-abx152417	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx053857-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) CLIA Kit
20-abx491987	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx253693-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
SEA754Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
SEA754Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
SEA754Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
SEA754Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
4-SEA754Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Myosin Heavy Chain 1, Skeletal Muscle, Adult elisa. Alternative names of the recognized antigen: MYHSA1 MYHa MyHC-2X/D Myosin-1 Myosin Heavy Chain IIx/d
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult(MYH1)ELISA Kit
QY-E03032	Qayee Biotechnology	96T	EUR 361

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Protein
20-abx068140	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody Pair
20-abx370650	Abbexa	EUR 1622.00 EUR 1038.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody (FITC)
20-abx271252	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Antibody (Biotin)
20-abx271518	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Recombinant Treponema pallidum p15 (partial)
7-07552	CHI Scientific	100µg	Ask for price

Recombinant Treponema pallidum p15 (partial)
7-07553	CHI Scientific	500µg	Ask for price

Recombinant Treponema pallidum p15 (partial)
7-07554	CHI Scientific	1000µg	Ask for price

Recombinant Treponema pallidum p17 (Partial)
7-07564	CHI Scientific	100µg	Ask for price

Recombinant Treponema pallidum p17 (Partial)
7-07565	CHI Scientific	500µg	Ask for price

Recombinant Treponema pallidum p17 (Partial)
7-07566	CHI Scientific	1000µg	Ask for price

Recombinant Treponema pallidum p47 (Partial)
7-07576	CHI Scientific	100µg	Ask for price

Recombinant Treponema pallidum p47 (Partial)
7-07577	CHI Scientific	500µg	Ask for price

Recombinant Treponema pallidum p47 (Partial)
7-07578	CHI Scientific	1000µg	Ask for price

Recombinant Treponema pallidum TmpA (Partial)
7-07579	CHI Scientific	100µg	Ask for price

Recombinant Treponema pallidum TmpA (Partial)
7-07580	CHI Scientific	500µg	Ask for price

Recombinant Treponema pallidum TmpA (Partial)
7-07581	CHI Scientific	1000µg	Ask for price

MYL5 Myosin Light Chain 5 (1-173 a.a.) Human Recombinant Protein
PROTQ02045-1	BosterBio	Regular: 10ug	EUR 317
Description: _x000D_ MYL5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 197 amino acids (1-173 a.a.) and having a molecular mass of 22.1kDa.;MYL5 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ELISA kit for Human MYH1 (Myosin Heavy Chain 1, Skeletal Muscle, Adult)
ELK2107	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated ant Show more
Description: A sandwich ELISA kit for detection of Myosin Heavy Chain 1, Skeletal Muscle, Adult from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human MYH1 (Myosin Heavy Chain 1, Skeletal Muscle, Adult)
E-EL-H1430	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MYH1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MYH1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MYH1 (Myosin Heavy Chain 1, Skeletal Muscle, Adult) in samples from Serum, Plasma, Cell supernatant

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig)
4-PAA754Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (Tyr585~Ala794) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx360530-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx363586-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) CLIA Kit
20-abx496355	Abbexa	EUR 7645.00 EUR 4074.00 EUR 942.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Cow Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx512024-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dog Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx512025-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx512028-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
20-abx585038	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx574492-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
20-abx154425	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Sheep Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx364394-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Monkey Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx359028-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx355635-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) CLIA Kit
20-abx491988	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse)
4-PAA754Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
SEA754Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
SEA754Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
SEA754Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
SEA754Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
4-SEA754Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Myosin Heavy Chain 1, Skeletal Muscle, Adult elisa. Alternative names of the recognized antigen: MYHSA1 MYHa MyHC-2X/D Myosin-1 Myosin Heavy Chain IIx/d
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Myosin Heavy Chain 1, Skeletal Muscle, Adult(MYH1)ELISA kit
QY-E10228	Qayee Biotechnology	96T	EUR 361

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult(MYH1)ELISA kit
QY-E21041	Qayee Biotechnology	96T	EUR 361

IL6R (partial) Peptide
20-abx266289	Abbexa	EUR 495.00 EUR 815.00 EUR 356.00	10 mg 25 mg 5 mg
Shipped within 5-10 working days.

RVG protein, partial
80-1580	Fitzgerald	500 ug	EUR 1425
Description: Recombinant Rabies virus Glycoprotein(G), partial

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), APC
4-PAA754Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (Tyr585~Ala794) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAA754Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (Tyr585~Ala794) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Biotin.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), Cy3
4-PAA754Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (Tyr585~Ala794) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Cy3.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), FITC
4-PAA754Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (Tyr585~Ala794) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with FITC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), HRP
4-PAA754Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (Tyr585~Ala794) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with HRP.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), PE
4-PAA754Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (Tyr585~Ala794) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with PE.

Recombinant (E.Coli) Treponema pallidum p17 (Partial)
RP-1442	Alpha Diagnostics	100 ug	EUR 286

Recombinant (E.Coli) Treponema pallidum p47 ( partial)
RP-1444	Alpha Diagnostics	100 ug	EUR 286

Recombinant (E.Coli) Treponema pallidum TmpA (partial)
RP-1446	Alpha Diagnostics	100 ug	EUR 286

Recombinant (E.Coli) Treponema pallidum p15 (partial)
RP-1452	Alpha Diagnostics	100 ug	EUR 286

ELISA kit for Mouse MYH1 (Myosin Heavy Chain 1, Skeletal Muscle, Adult)
ELK2108	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated ant Show more
Description: A sandwich ELISA kit for detection of Myosin Heavy Chain 1, Skeletal Muscle, Adult from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
abx357674-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), APC
4-PAA754Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA754Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Biotin.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), Cy3
4-PAA754Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with Cy3.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), FITC
4-PAA754Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with FITC.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), HRP
4-PAA754Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with HRP.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), PE
4-PAA754Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with PE.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAA754Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (Tyr585~Ala794) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Pig Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC-Cy7.

MYH1 siRNA
20-abx925144	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYH1 siRNA
20-abx925145	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYH1 antibody
70R-3929	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MYH1 antibody raised against the N terminal of MYH1

MYH1 Antibody
35828-100ul	SAB	100ul	EUR 252

MYH1 Antibody
31804-100ul	SAB	100ul	EUR 252

MYH1 Antibody
1-CSB-PA877584	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MYH1 Antibody
1-CSB-PA791340	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

MYH1 Antibody
1-CSB-PA015289ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Recombinant Treponema pallidum p15 (Partial), His Tag
7-07558	CHI Scientific	100µg	Ask for price

Recombinant Treponema pallidum p15 (Partial), His Tag
7-07559	CHI Scientific	500µg	Ask for price

Recombinant Treponema pallidum p15 (Partial), His Tag
7-07560	CHI Scientific	1000µg	Ask for price

Recombinant Human Myosin Light Chain 1
7-05632	CHI Scientific	2µg	Ask for price

Recombinant Human Myosin Light Chain 1
7-05633	CHI Scientific	10µg	Ask for price

Recombinant Human Myosin Light Chain 1
7-05634	CHI Scientific	1mg	Ask for price

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA754Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1). This antibody is labeled with APC-Cy7.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
WEA754Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4181.72
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
WEA754Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 432.02
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
WEA754Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 574.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
WEA754Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2284.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
4-WEA754Mu	Cloud-Clone	EUR 4232.00 EUR 2235.00 EUR 575.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Myosin Heavy Chain 1, Skeletal Muscle, Adult elisa. Alternative names of the recognized antigen: MYHSA1 MYHa MyHC-2X/D Myosin-1 Myosin Heavy Chain IIx/d
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Wide-range Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Interleukin-6 Receptor (partial)
5-01403	CHI Scientific	4 x 5mg	Ask for price

Anti-Myosin VI Antibody
A02627-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for Myosin VI Antibody (MYO6) detection.tested for IHC, WB in Human, Mouse, Rat.

Human MYH1 ELISA Kit
ELA-E0161h	Lifescience Market	96 Tests	EUR 824

MYH1 ELISA KIT|Human
EF000470	Lifescience Market	96 Tests	EUR 689

Human MYH1 shRNA Plasmid
20-abx953047	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant human Myosin-6
P1315	FN Test	100ug	Ask for price
Uniprot ID: P13533 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Myosin-6

Recombinant human Myosin-6
P1499	FN Test	100ug	Ask for price
Uniprot ID: P13533 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Myosin-6

Recombinant human Myosin-11
P2913	FN Test	100ug	Ask for price
Uniprot ID: P35749 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Myosin-11

Recombinant human Myosin-4
P2914	FN Test	100ug	Ask for price
Uniprot ID: Q9Y623 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Myosin-4

MYH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1373702	ABM	1.0 ug DNA	EUR 154

Recombinant (E.Coli) Treponema pallidum p15 (Partial), His-tag
RP-1448	Alpha Diagnostics	100 ug	EUR 286

Anti-MYO1D/Myosin Id Antibody
A09126-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal MYO1D/Myosin Id Antibody. Validated in IHC and tested in Human, Mouse, Rat.

MYH1 Conjugated Antibody
C35828	SAB	100ul	EUR 397

MYH1 Conjugated Antibody
C31804	SAB	100ul	EUR 397

MYH1 cloning plasmid
CSB-CL015289HU-10ug	Cusabio	10ug	EUR 2770
Formulation: 10 μg plasmid + 200μl Glycerol Length: 5820 Sequence: ATGAGTTCTGACTCTGAGATGGCCATTTTTGGGGAGGCTGCTCCTTTCCTCCGAAAGTCTGAAAGGGAGCGAATTGAAGCCCAGAACAAGCCTTTTGATGCCAAGACATCAGTCTTTGTGGTGGACCCTAAGGAGTCCTTTGTGAAAGCAACAGTGCAGAGCAGGGAAGGGGGGA Show more
Description: A cloning plasmid for the MYH1 gene.

MYH1 Polyclonal Antibody
ES11981-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MYH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYH1 Polyclonal Antibody
ES11981-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MYH1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- MYH1 antibody
FNab05469	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:100 Immunogen: myosin, heavy chain 1, skeletal muscle, adult Uniprot ID: P12882 Gene ID: 4619 Research Area: Cancer, Immunology, Developmental biology
Description: Antibody raised against MYH1

anti- MYH1 antibody
FNab05470	FN Test	100µg	EUR 548.75
Immunogen: myosin, heavy chain 1, skeletal muscle, adult Uniprot ID: P12882 Gene ID: 4619 Research Area: Cancer, Immunology, Developmental biology
Description: Antibody raised against MYH1

MYH1 Polyclonal Antibody
ABP59360-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MYH1 protein Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody
ABP59360-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MYH1 protein Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody
ABP59360-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MYH1 protein Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Rabbit pAb
A6935-100ul	Abclonal	100 ul	EUR 308

MYH1 Rabbit pAb
A6935-200ul	Abclonal	200 ul	EUR 459

MYH1 Rabbit pAb
A6935-20ul	Abclonal	20 ul	EUR 183

MYH1 Rabbit pAb
A6935-50ul	Abclonal	50 ul	EUR 223

MYH1 Blocking Peptide
33R-4695	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH1 antibody, catalog no. 70R-3929

Anti-MYH1 antibody
PAab05469	Lifescience Market	100 ug	EUR 412

Anti-MYH1 antibody
PAab05470	Lifescience Market	100 ug	EUR 386

Anti-MYH1 antibody
STJ29015	St John's Laboratory	100 µl	EUR 277
Description: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development.

Anti-MYH1 antibody
STJ193139	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MYH1

Высокоэффективная жидкостная хроматография в частично денатурирующих условиях ( dHPLC ) – это быстрый и экономичный метод скрининга молекулярных дефектов: четыре новые мутации, обнаруженные при Х-сцепленной хронической гранулематозной болезни.

 Внедрение точных методов в рутинной диагностике хронической гранулематозной болезни (ХГБ), которые ускоряют скрининг молекулярных дефектов, может иметь решающее значение для быстрого предположения прогноза пациента. В этом исследовании сравнивалась эффективность анализа однонитевого конформационного полиморфизма (SSCP) и высокоэффективной жидкостной хроматографии в частично денатурирующих условиях (dHPLC) для скрининга мутаций у пациентов с CGD. Мы отобрали 10 пациентов мужского пола с ХГБ, в анамнезе которых были тяжелые рецидивирующие инфекции и нарушение функции респираторного взрыва. Образцы гДНК, мРНК и кДНК получали стандартными методами. Экзоны CYBB амплифицировали с помощью ПЦР и проверяли с помощью SSCP или dHPLC. Аномальные фрагменты ДНК секвенировали, чтобы выявить природу мутаций.

Методы SSCP и dHPLC показали аномалии ДНК соответственно в 55% и 100% случаев. Секвенирование образцов аномальной ДНК подтвердило мутации во всех случаях. Были идентифицированы четыре новые мутации в CYBB, которые были обнаружены только при скрининге dHPLC (c.904 insC, c.141 + 5 g> t, c.553 T> C и c.665 A> T) . Эта работа подчеркивает актуальность dHPLC, чувствительного, быстрого, надежного и экономичного метода скрининга мутаций при CGD, который в сочетании с функциональными анализами, оценивающими респираторный взрыв фагоцитов, будет способствовать ускорению окончательной диагностики X-сцепленного CGD, непосредственно лечение, генетическое консультирование и четкое предположение о прогнозе. Эта стратегия особенно подходит для развивающихся стран.

Использование  DHPLC  (денатурирующая высокоэффективная жидкостная хроматография) при скрининге II уровня гена CFTR в пренатальной диагностике.

 ЦЕЛЬ

Цель исследования – оценить роль денатурирующей высокоэффективной жидкостной хроматографии (DHPLC) во втором уровне скрининга гена регулятора трансмембранной проводимости при муковисцидозе (CFTR).

МЕТОДЫ

9-месячное проспективное исследование, проведенное в период с июня 2008 г. по март 2009 г. в Медицинском центре Artemisia Fetal Medical Heart, включало 3829 образцов околоплодных вод у женщин, перенесших амниоцентез в середине триместра. Генетический диагноз CF был основан на исследовании основных мутаций CFTR. ген на ДНК плода, выделенный из амниоцитов (скрининг первого уровня) с использованием различных коммерческих диагностических систем. Скрининг второго уровня с использованием DHPLC на амниотической жидкости и образце крови пары был предложен в случае гетерозиготных на первом уровне плода.

ПОЛУЧЕННЫЕ РЕЗУЛЬТАТЫ

Из 3829 плодов 134 оказались положительными, 129 – гетерозиготными и 5 – пораженными . Из 129 пар после соответствующего генетического консультирования 53 запросили скрининг второго уровня. При использовании DHPLC 44 пары оказались отрицательными, а в девяти парах были идентифицированы девять редких мутаций.

ВЫВОДЫ

Скрининг первого уровня может быть полезен для выявления до 75% мутаций МВ . Скрининг второго уровня позволяет выявить еще 10% мутантных аллелей. Было обнаружено, что DHPLC является надежным и специфическим методом быстрой идентификации редких мутаций CFTR, которые не были обнаружены при первоначальном скрининге первого уровня.

 Эффективность dHPLC для полуавтоматического анализа кДНК-AFLP и сбора фрагментов в модели гена устойчивости к парше яблони.

Анализ кДНК-AFLP для профилирования транскриптов был успешно применен для изучения многих биологических систем растений, особенно взаимодействий между растениями и микробами. Однако, как сообщается , разделение фрагментов кДНК-AFLP с помощью гель-электрофореза является трудоемким с ограниченным потенциалом автоматизации, а сбор дифференциальных полос для идентификации генов является еще более трудоемким.

В этой работе мы представляем использование dHPLC (денатурирующая высокоэффективная жидкостная хроматография) и автоматизированный сбор фрагментов ДНК с использованием системы WAVE (®) для анализа и восстановления фрагментов кДНК-AFLP .

Этот метод успешно применяется к взаимодействию Malus-Venturia inaequalis , что позволяет собрать 66 различных фрагментов, полученных из транскриптов для генов яблока, предположительно участвующих в защитной реакции, активируемой геном устойчивости к HcrVf2.

Результаты, подтвержденные количественной ОТ-ПЦР в реальном времени, согласуются с исследуемым взаимодействием растения и патогена, и это дополнительно подтверждает пригодность dHPLC для профилирования транскриптов кДНК-AFLP . Обсуждаются особенности и преимущества этого нового подхода, демонстрирующие, что это почти полностью автоматизируемое и экономичное решение для обработки большого количества образцов и сбора дифференциальных генов, участвующих в других биологических процессах и немодельных растений.